Schedule

Date Time Activity
Mon 03/11/2024 10:00 to 16:00 Unix-like systems, bash, connecting to SCWales
Tue 04/11/2024 10:00 to 16:00 More bash, SCWales, using SCWales and slurm
Wed 05/11/2024 10:00 to 16:00 Illumina data, BEARCAVE, data processing
Thu 06/11/2024 10:00 to 16:00 ANGSD, covariance and distance matrices, heterozygosity, intro to R
Fri 07/11/2024 10:00 to 16:00 Maps, PCA’s, NJ trees, Manhattan plots and Rmarkdown

Prequisites

  • a computer with internet connection
  • an account on super-computing Wales
  • basic knowledge of DNA and genome structure

Resources

Introductions

Axel Barlow, Lecturer in Zoology at Bangor University

Interests - Population and evolutionary genomics of animals. Palaeogenomics of extinct animals. Conservation genomics of native species

Bioinformatics experience

  • Self taught post-PhD
  • No proper bioinformatics/computer science background
  • Knowledge of bash and R.

Johanna Paijmans, Lecturer in Zoology at Bangor University

Interests - Population and evolutionary genomics of animals. Palaeogenomics of extinct animals. Drivers of population dynamics through time

Bioinformatics experience

  • Self taught (by rebelling against a Linux-expert father)
  • No proper bioinformatics/computer science background
  • Knowledge of bash and R.

Unix-like systems and bash

Unix

  • Operating system developed in 1969 by Bell Labs
  • Unix philosophy: operating system should provide a set of simple tools, each of which performs a limited, well-defined function.
  • Modular (small programs strung together)
  • Inter-process communication: “pipes”
  • Separate normal and “super” users (sudo)
  • Hierarchical filesystem
  • A shell for executing and combining tools
  • The basis of many subsequent OS


Unix

Unix-like systems

Mac OS

  • Released 1984
  • Developed from NeXTSTEP, which is developed from Unix
  • Proprietary, only available with Apple hardware

Linux

  • 21 year old Linus Torvalds coded a Unix inspired OS in 1991
  • Free and open source
  • The core linux kernal available under many distributions: Ubuntu, Mint, Arch, RedHat, Android, Tesla, etc.

MS-DOS (Windows)

  • Developed by Microsoft, released 1981
  • Main OS for IBM PCs in 1980s
  • GUI introduced with Windows, released 1985
  • Largest market share (70% of PCs)
  • Some bioinformatics possible (e.g. R typically via Rstudio)
  • No bash
  • Encoding of text files is different
  • Majority of bioinfomatics software unsupported
  • Windows subsystem for linux https://learn.microsoft.com/en-us/windows/wsl/install
  • Seamless transfer between DOS and Unix not yet possible

OS comparison

Windows Mac
standard PC functions yes yes
cost yes yes
hardware choice yes no
bioinformatics no yes
HPC no no
open source no no
active community no no
games yes some

Terminal emulators and Bash

  • a shell allows users to execute OS tools
  • Accessed using a terminal
  • Unix terminal came with the Bourne shell (sh), developed by Steven Bourne in 1979
  • In 1979 Brian Fox in improved version: the Bourne again shell (bash)
  • Most Unix-like OS use bash or something like it
    • execute standard OS functions and installed programs
    • access filesystem
    • supports bash scripts
    • pipes, auto-completion, loops, wildcards, etc.

Supercomputing Wales and slurm

Supercomputing Wales (SCW)

  • £16m investment, part-funded by the European Regional Development Fund (ERDF) through Welsh Government
  • Provide university research teams access to HPC (High Performance Computing)
  • Consortium of Cardiff, Swansea, Bangor and Aberystwyth
  • 2 Supercomputers:
    • Cardiff HPC System - Hawk
    • Swansea HPC System - Sunbird
  • Hawk: >300 nodes, >20,000 cores, >100 TB memory
  • (yours: 1 node, 4-16 cores, 8-32 Gb memory)

Hawk (soon to be retired! Followed by Falcon)

Hawk

  • Computational nodes
    • >134x Intel nodes with 40 cpus + 192 Gb RAM each
    • >64x AMD nodes with 64 cpus + 256 Gb RAM each
    • >26x Highmem nodes with 384 Gb RAM each
    • >28x Nvidia GPU nodes
  • Storage space
    • 1192TB (usable) scratch space
    • 420TB of home directory space
  • Access
    • Multi-factor authentication (MFA)
    • SSH jump host

Hawk

  • Scientific Linux OS
    • Command-line only (ssh)
    • File transfer using scp
  • Space & quota
    • Home directory (small, persistent): 50Gb
    • Scratch space (bigger, temporary): SCW projects, few Tb
    • Max 10 active jobs, max 30 in the queue
    • Max 3 day runtime

SCW Usage

  • Access through SSH jump host
  • Command-line only (via ssh)
  • File transfer using scp or sftp
  • Job submission using slurm job scheduler
  • Many software installed as modules
  • No super user access

Filesystem

  • / [root] is uppermost level of filesystem
  • Everything is contained in /
  • Directories exist within the filesystem, they can contain files and other directories
  • We specify a path through this hierarchy using forward-slashes
  • Our current directory is called the working directory
/home/b.xlb21brx/
/scratch/b.xlb21brx/
  • We can navigate through the filesystem (change working directory)
  • Or we can specify the patch to directories or files remotely

Slurm

  • Simple Linux Utility for Resource Management: Slurm
  • Free open source job scheduler for linux systems
  • Used on 60% of World’s top 500 computers
  • Assigns user jobs to computer resources
  • Submit to queue
  • Short, low-resource jobs move faster through the queue
  • Other tools for scheduling, reporting, etc

AI

A brief note on AI in Bioinformatics

  • AI tools are becoming increasingly common in bioinformatics
  • It’s incredible powerful, but keep various considerations in mind (ethics, reproducibility, accuracy, privacy…)
  • Different models are better or worse for different tasks (ChatGPT 4 is not great at programming)

A brief note on AI in Bioinformatics

Illumina data

Illumina sequencing platforms

Data output

Platform Million reads Read length Gb data Genome coverage
iSeq 4 2 x 150 bp 1.2 0.4
MiniSeq 25 2 x 150 bp 7.5 2.5
MiSeq 100 2 x 500 bp 30 10
Nextseq 550 400 2 x 150 bp 120 40
NextSeq 1000/2000 1800 2 x 300 bp 540 180
NovaSeq 6000 20000 2 x 250 bp 3000 1000
NovaSeq X 52000 2 x 150 bp 8000 2667

Sequencing by synthesis

Sample preparation

*Indexes allow multiple samples to be sequenced at the same time

Flow cell

bg:white

Cluster generation

Sequencing by synthesis

Data analysis (in the machine)

What do we sequence?

[Not an exhaustive list]

  • Whole genome sequencing (pure DNA sample from a single individual)
  • Reduced representation genome data (RADseq, targeted SNPs, single individual)
  • Poolseq (multiple individuals)
  • Transcriptome (RNA sample from single tissue/individual)
  • Metabarcoding (PCR amplicon, multiple individuals/species)
  • Metagenomics (whole genomes, multiple individuals/species)

Whole genome sequencing

Short reads from a single individual can be mapped to a reference genome assembly

Whole genome sequencing

Illumina summary

  • The current market leader
  • Massive output
  • Many applications (genome resequencing, RADseq, transcriptomes, metabarcoding)
  • Cheap (£10 per Gb)
  • Major limitation is the read length

BEARCAVE

BEARCAVE

  • Nikolas Basler, Achim Klittich, Axel Barlow
  • An environment for organising, processing, and archiving Illumina data
  • BEARCAVE philosophy
    • All users can access all data
    • Avoid data redundancy
    • All samples processed using identical software programs and parameters
    • Incorporates sample metadata
    • Documents results of data processing
    • Easy to use wrapper scripts for programs
    • Publicly available
    • Safeguards in place to ensure consistency
  • Consequently BEARCAVE is not for everyone, and has idiosyncrasies in use

Our project: adder population genomics

  • Adders (Vipera berus berus) widespread across northern Eurasia
  • Threatened or near-threatened in UK
  • Illumina PE data from 27 individuals
  • Plus one outgroup (Vipera berus bosniensis)
  • 7 locations
  • Our tasks
    • Data format
    • Adapter trimming and read merging
    • Map to reference genome: chr7

*** =right

Adder locations

sample|locality | adder01-04|Dublin adder05-08|Belfast adder09-12|Cork adder13-16|Limerick adder17-20|Galway adder21-24|Dundalk adder25-27|Bray adder28|outgroup

Illumina data processing

.fastq file format

  • fastq is the standard output format for data from Illumina (and other) platforms
@A00551:758:HKTVJDSX7:4:1101:3595:6872 1:N:0:CCTGAGATGT+GGTCTAGTTG
CTGAATATGGATTTTAATTGAATCCTAAGATATTATAGCATCTTTCACTCCCTGTCCTGTGCATGTCAGA
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
  • Line 1: info on sequencer, flowcell, cluster position, indexes (sometimes)
  • Line 2: called bases
  • Line 3: a +
  • Line 4: quality scores on Phred scale
  • 10 = 90% accuracy; 20 = 99% accuracy; 30 = 99.9% accuracy
  • Recoded as single character: F = 37; ? = 30; 5 = 20; + = 10

Adapter trimming and read merging

DNA fragment length distribution

  • DNA can be fragmented
  • The fragment lengths have a distribution

45 ka cave bear (Ursus kudarensis)

Effect of insert size

Effect of insert size

Effect of insert size

Effect of insert size

Effect of insert size

Effect of insert size

Adapter trimming

Overlapping reads are merged

BEARCAVE script

  • decompress fastqs
  • trim adapter seqs using Cutadapt
    • 30 bp min length
    • min overlap 1 bp
  • merge overlapping read pair using FLASH
  • recompress files and clean up
  • save appropriate log files

Expected output in /BEARCAVE2/trimdata/*processing/

  • merged reads *_mappable.fastq.gz [big file]
  • unmerged R1 *_mappable_R1.fastq.gz [big file]
  • unmerged R2 *_mappable_R2.fastq.gz [big file]
  • trim report *_trim_report.log and merge report *_merge_report.log

Cutadapt

FLASH

Mapping

BEARCAVE mapping script

  • decompress fastqs
  • merged (SE) and PE data processed separately
    • mapping using bwa mem algorithm
    • PCR duplicates identified and removed using samtools
    • Reads with poor mapping quality (Q30) removed using samtools
  • SE and PE data merged
  • mapping log file generated
  • file cleanup and renaming

Expected output in /BEARCAVE2/mapped*/*processing/

  • mapped filtered data *.bam [big file]
  • bam index *.bam.bai
  • mapping log *_mapping.log

bwa

samtools (48,024 citations)

.segue .dark

Population genomics using angsd

angsd

  • Widely used program
  • MANY population genetics analyses possible
  • Tends to work directly from bam files (unlike plink, admixtools, etc)
  • MANY filters available
  • Genotype likelihood approach is a particular speciality

Allele1|Allele2|prob11|prob12|prob22 |||| A|T|0.05|0.9|0.05

  • Several spin off programs that use GLs
    • NGSadmix
    • PCangsd
    • NGSrelate
    • realSFS

angsd website

angsd paper

Covariance matrix, distance matrix, heterozygosity

Covariance matrix

  • All indviduals
  • Allele frequency covariance matrix
  • Used for PCA

Distance matrix

  • All individuals
  • absolute genetic distance between populations
  • used as input for NJ algorithm

Heterozygosity

  • Your single adder
  • Calculate GLs, ML estimation of SFS along a sliding window using realSFS

Intro to R

What is R

  • Statistical analysis
  • Data visualisation
  • Free and open source
  • Linux, Mac, Windows
  • Many additional packages
  • Several GUIs e.g. Rstudio
  • Graphics (even interactive), text documents, websites
  • This presentation!

How R works

Why is bash faster than R?

Suppose you’re a survey company. To carry out your survey you need all the people seated in a classroom, which you have to build. You’re not sure how many, so you build an ordinary classroom, with 5 rows of 6 desks for 30 people, after 30 people file in you notice there’s a 31st. You build a second 30-person classroom right next to the first, and now you can accept 60 people, but then you notice a 61st. So you ask them to wait, and you build two more classrooms, so now you’ve got a nice 2x2 grid of 30-person classrooms, but the people keep coming and soon enough the 121st person shows up and there’s not enough room. So you build a big 5-story building next door with 50-person classrooms, 5 on each floor, for a total of 50 x 5 x 5 = 1,250 desks, and you have the first 120 people file out of the old rooms into the new building, and you hire some wreckers to demolish the old classrooms and recycle some of the materials, and the people keep coming. And when you’re all done with all this, the only “survey question” you’re going to ask is “How many rows are there?”

Meanwhile, Bob’s discount survey company, who can only tell you how many people he surveyed, is down there on the streetcorner, and the people are filing by, and Bob is jotting down tally marks on his clipboards, and the people, once surveyed, are walking away and going about their business, and Bob isn’t wasting time and money building any classrooms at all.

Why is bash faster than R?

Rstudio

  • GUI
  • Preferred by many
  • Linked to tidyverse
  • Linked to R markdown
  • Version control and other development tools

Tidyverse

  • ggplot2
  • tibble
  • tidyr
  • readr
  • dplyr
  • stringr
  • purr
  • forcats
  • “Tidy data”
  • “Grammar of graphics”

Opinions on R from a heretic

Most people disagree (in some cases strongly)

  • Rstudio is terrible (except for R markdown)
  • Base R is really good
  • ggplot2 code is hellishly complex
  • tidyverse is not the way to teach R to beginners
  • It’s boring if everyone’s graphs look the same
  • It’s OK to type commands directly into the terminal
  • It’s OK to modify a raw data file
  • It’s OK to combine other tools and languages
  • Data doesn’t have to be tidy

Functionality

Objects and functions

Objects

  • Contain data and results
  • Created with <-
  • Stored in active memory
  • Names include letters numbers _ .
  • Names must begin with a letter

Functions

  • Carry out operations on objects
  • Often generates new objects
  • function()
  • ?function

Data structures: vector and matrix

Vector

  • List of values of the same type
  • Numbers, strings, or logical values
  • Can be generated using c()
  • Indexing vector objects my_vector[]

Matrix - 2D data of same type in rows and columns - Indexing matrix objects my_matrix[row, column]

Data structures: dataframe and list

Dataframe - Rectangular “table” - Mixture of data types - Set of vectors of equal length - Extract columns with $, which can then be indexed like vectors

List - Set of components with different structures - Extract named components with $

Population genetics: PCA

  • Input is allele covariance matrix
  • eigen decomposition eigen()
  • Actually a recent method
  • No knowledge of PC loadings in terms of SNPs/sites
  • PC scatterplot
  • PC variance explained

*** =right

Population genetics: Neighbour-joining clustering

  • Input is distance matrix
  • Neighbour joining algorithm
  • Clusters based on genetic similarity
  • Rooted using outgroup
  • Requires ape library
  • Basic estimate of phylogeny

Heterozygosity

  • Input is sliding window estimates of heterozygous sites

That’s all folks!

See you next year :)